DNA Hybridization - Kinased Oligonucleotides

Jeff Lawrence

1. Prehybridize filters at 65° for 2 hr. Remove fluid from bag and rinse twice with hybridization fluid if different.

2. Add 5 mL hybridization fluid per 15 cm2 of filter:

	6 X		NET
	0.5 %		Sarkosyl
	100 mg/mL	Denatured Salmon Sperm DNA

20X NET is:

	3.0 M	NaCl		60 mL	5 M NaCl
	0.3 M	Tris, pH 7.5	30 mL	1 M Tris, pH 7.5
	20 mM	EDTA		4 mL	500 mM EDTA
				6 mL	ddH₂O

3. Add purified kinased oligonucleotide to a concentration of 1 ng/mL.

4. Seal bag and hybridize at 22° for 2 hr.

5. Remove filter and place in 500 mL of Rinse Solution:

	6 X	SSC		300 mL	20X SSC
	0.06 %	NaPyrophosphate	100 mL	0.6% NaPP
	20 mM	NaPO4, pH 7	20 mL	1 M NaPO4, pH 7
	0.1 %	SDS		10 mL	10% SDS
				570 mL	ddH₂O

6. Rinse with shaking for 5 min. Repeat rinse.

7. Transfer filter to 500 mL Rinse Solution preheated to the Tm calculated as:

	4*(# of G or C bases)  +  2*(# of A or T bases)

example, melting of GCACTTGAATCTAGGATCCG is :

	4*(10) + 2*(10)  =  40 + 20  =  60°

8. Rinse with agitation for 2 min. Remove and wrap in plastic wrap.

Last Update: Thursday June 19 2014

This page has been viewed Failed to execute CGI : Win32 Error Code = 2
times.

Eric Kofoid eckofoid at ucdavis.edu