Nested DNA Amplification Products ("N Ladders")

Eric Kofoid (26 July 1995)

Description
==========
This protocol allows generation of a series of nested amplification products from a chunk of DNA with a known primer binding site at one end. I have tested it only with PCR products. However, as it is essentially a "known-to-unkown" method, it ought to work for chromosome walking as well. The method is poorly optimized and should be considered preliminary. However, with PCR products or mud-P22 lysates, it has essentially always worked.
Typical "N primers" have the following structure:

"N2G" ACTTCTCAACAACTCAGGACGAACANNNNNNNNNNGCAGC
This example has a 10 base degenerate 3' tail (N's) followed by constant pentamer (GCAGC). It is used to randomly prime into unknown regions from a known anchor. The constant end will recognize sites separated by an average of 1024 bases. It is used in conjunction with three other primers having the same 3' tetramer preceeded by A, T, or C ("N2A", "N2T" and "N2C"). Conditions are adjusted to allow only partial 3' laydown.

The tract of 25 nucleotides at the 5' end has been chosen at random. A "P primer" identical to this tract is used for subsequent PCR amplification of the nested products:
"P" ACTTCTCAACAACTCAGGACGAACA
I have also used an N primer (N1) with a four base constant 3' end (CACA). This yields nested products separated by an average of 256 bases. In general, these are too closely spaced for easy band isolation from an agarose gel.
Protocol
==========

N Extension Reaction

10 µL H2O
2 µL 10x M-PCRB
2 µL 4 dNTPs @ 2 mM each
2 µL N primer @ 5 µM
2 µL template diluted to about 1 ng/µL
2 µL "T/TS" @ 0.4 u/µL
------
20 µL

Load 20 µL glass capillaries and do one round of primer extension in Idaho Technology Rapidcycler using the following program:

1 cycle 0"x94¡ 0"x40¡ 5'x72¡ with ramp (S) = 6
Remove primers using Promega Wizard Kit, following manufacturer's protocol.

Amplification Reaction

8 µL H2O
2 µL 10x M-PCRB
2 µL 4 dNTPs @ 2 mM each
2 µL P primer @ 5 µM
2 µL known primer @ 5 µM
2 µL product of above extension reaction
2 µL "T/TS" @ 0.4 u/µL
------
20 µL

Load 20 µL glass capillaries and amplify using the following program:

45 cycles 0"x94¡ 0"x55¡ 1'x72¡ (or longer if needed) with ramp (S) = 9
Hold 5'x72¡C
Remove primers as before.

Band Purification

Separate products electrophoretically on 0.8% regular agarose and core bands of interest. Soak cores in 100 µL H2O and reamplify using the conditions in step 2 above with C=30. It is often difficult to avoid extra bands on reamplification. Excise the correct band with a fresh razor blade, and isolate the DNA by GeneClean (Bio 101) or other purification method of choice.
Materials
==========

10x M-PCRB
500 mM Tris, pH 8.3
2.5 mg/mL BSA
20 mM MgCl2
5 % Ficoll
5 mM cresol red

T/TS
10.5 µL EDB
1 µL Taq Polymerase (Promega) @ 5 u/µL
1 µL TaqStart antibody (CloneTech) as delivered

EDB
2.5 mg/ml bovine serum albumin in 10 mM Tris, pH 8.3