DNA Reaction - Polymerase Chain Reaction

Jeff Lawrence

1. Calculate the annealing temperature of oligos as:
	4*(# of G or C bases)  +  2*(# of A or T bases)  -  3
Example: melting of GCACTTGAATCTAGGATCCG is :
	4*(10) + 2*(10) - 3  =  40 + 20 - 3  =  60 - 3  =  57°
Use the lowest temperature as the annealing temperature:

2. Program Thermal Cycler with the following parameters:
	Step		Temp	Time
	=======		======	======
	Melting		94°	30 sec
	Annealing	40-65°	30 sec
	Extending	72°	1 min per kilobase target.
3. Dilute template DNA:
	Template	Concentration (per mL)
	========	=============
	Eucaryotic	20 ng
	Bacterial	5 ng
	Lambda		1 ng
	Plasmid		100 pg
	PCR Product	50 pg
4. Mix the following:
	1.0 µL	Template DNA (1/100 dilution of chromosomal DNA)
	2.0 µL	10X TAQ Buffer (MgCl2 between 1 and 3 mM final)
	2.0 µL	8 mM dNTP (2 mM each)
	2.0 µL	5 mM Primer 1
	2.0 µL	5 mM Primer 2
	0.1 µL	TAQ Polymerase, at 5 unit/µL
	10.9 µL	ddH2O						
	20.0 µL	Total volume
5. Cycle for 25 cycles, up to 30 cycles for eukaryotic templates.

Last Update: Thursday, 19-Jun-2014 11:50:21 PDT
This page has been viewed 213 times.
Eric Kofoid eckofoid at ucdavis.edu