DNA Reaction - PCR in Air Cyclers
Jeff Lawrence
1. Calculate the annealing temperature of oligos as:
4*(# of G or C bases) + 2*(# of A or T bases) - 3
example, melting of GCACTTGAATCTAGGATCCG is :
4*(10) + 2*(10) - 3 = 40 + 20 - 3 = 60 - 3 = 57°
Use the lowest temperature as the annealing temperature:
2. Program Air Cycler with the following parameters:
Step Temp. Time
====== ====== =====
Melting 94° 2 sec
Annealing 40-72° 2 sec
Extending 72° 15 sec + 40 sec per kilobase target.
3. Dilute template DNA:
Template Concentration (per mL)
========== =============
Eucaryotic 20 ng
Bacterial 5 ng
Lambda 1 ng
Plasmid 100 pg
PCR Product 50 pg
4. Mix the following:
1.0 µL Template DNA
2.0 µL 10X TAQ Buffer (MgCl2 between 1 and 3 mM final)
2.0 µL 8 mM dNTP (2 mM each)
2.0 µL 5 mM Primer 1
2.0 µL 5 mM Primer 2
0.1 µL TAQ Polymerase, at 5 unit/mL
10.9 µL ddH2O
20.0 µL Total volume
5. Load sample into a glass capillary tube and seal both ends.
6. Cycle for 30 cycles with a rapid slope between temperatures