Standard PCR
Eric Kofoid (July 17, 1996)
Description
==========
These are recipes and protocols for PCR using Taq polymerase in the Idaho Technology Air Cycler. They work well for me.
Protocol
==========
- Typical Reaction
- 8 µL H2O
- 2 µL 10x M-PCRB (the usual buffer)
- 2 µL 4 dNTPs
- 2 µL left primer @ 5 µM
- 2 µL right primer @ 5 µM
- 2 µL template, diluted 10-2 - 10-3
- 2 µL T/TS
- ------
- 20 µL
- Typical settings
- hold 30"x94¡ (chromosomal templates only)
- 30-40 cycles 0"x94¡ 0"x45-65¡ 15" or greater x72¡
- 5' x 72¡
- Comments
- ==========
- For analytical runs, use 10 µL (4 cm of a "10µL" Idaho-Tech glass capillary).
To maximize yield, draw the entire reaction into the capillary. For preparative
work, distribute a 5 or 10x reaction over several capillaries, about 20 µL per tube.
Using a hot flame, seal the end of the capillary containing the short air
bubble. Than, quickly draw the opposite end over the flame to expand the
bubble and seal it immediately. This will prevent a glass ball from
inflating.
-
Large volumes can also be cycled in traditional thin-walled PCR tubes by
placing them in special mounts which ship with the machines. However, runs are
shorter and products purer if the capillaries are used.
- Open capillaries at the large bubble end first. Use a light stroke with
a sapphire knife. Remove the other end and load directly into an
agarose well with a Drummond capillary pump.
- The correct buffer and annealing temperature can be determined by "3x3"
optimization (see below). Usually, M-PCRB works fine.
- Annealing temperatures
can often be guessed at fairly accurately using programs such as GCG
"prime". 55¡ is often adequate for primers greater than 18 nucleotides with
average nucleotide composition and no internal structure.
- As a rule of thumb,
15-30" elongation is sufficient for a typical 1 Kb piece with matched primers that
bind well. Longer products do not scale linearly, and require more time than
one might expect (e.g., 1-2' for 2 Kb). Don't expect to make anything larger than
5.5ÊKb without resorting to other methods.
- After cycling, reactions can
be stored in capillaries indefinitely at room temp.
- "3x3" optimizations:
- ==========
- Make 3 40 µL reactions using H-PCRB, M-PCRB and
L-PCRB, and aliquot 10µL each into 3 capillaries.
- Cycle sets (H-, M-, L-PCRB) at annealing temperatures 50¡, 55¡ or 60¡.
- Load in 9 adjacent wells in order:
- H(50¡)->M(50¡)->L(50¡)->H(55¡)->M(55¡)->L(55¡)->H(60¡)>-M(60¡)->L(60¡).
- This gives increasing stringency, left to right.
- Controls
- ==========
- Single-primer PCR: Secondary primer binding sites will
sometimes occur by chance near the specific site such that an unwanted
amplification product flanked at both ends by the same oligonucleotide.
The probability of such an event increases greatly with decreased
stringency of binding. These unwanted products can be detected by running
PCR reactions with each primer alone.
- "Universal" positive control: The quality of any E.coli
or Salmonalla chromosomal DNA preparation having an intact
cheY gene can be checked using the balanced CheY universal
primers:
- CheY1 (TP43): ATGGCGGATAAAGAACTTAAATTTTTGG
- CheY2 (TP44): AGTCGCATCCTCACATGCCCAGTTTCTCAAAGAT
- The product size is 399. The oligonucleotides were designed by Knut
Jahreis, and work equally well in both organisms under nearly all possible
conditions. For instance, in a standard "3x3" optimization, these two
primers will yield 9 nearly identical lanes, each with a single band of
size 399 bp.
- Materials
- ==========
- Enzyme Dilution Buffer (EDB) -- store 1 mL aliquots at -20¡.
- 10 mM Tris, pH 8.3 [10 µL 1M ]
- 2.5 mg/mL BSA (crystalline, not acetylated!) [25 µL 100 mg/mL]
[0.97 mL H2O -> 1 mL]
- 10x Taq polymerase stock (T/TS) -- store 100 µL aliquots at -20¡C
- 1 µL Taq @ 5 u/µL
- 1 µL TaqStart antibody @ Clontech's concentration.
- 10.5 µL EDB
- 10x H-, M- or L-PCRB -- store at -20¡C.
- 500 mM Tris, pH8.3 [500 µL 1 M]
- 2.5 mg/mL BSA (crystalline, not acetylated!) [25 µL 100 mg/mL]
- 5% Ficoll [200 µL 25%]
- 1 mM Cresol Red [10 µL 100 mM]
- 30, 20 or 10 M MgCl2 [30, 20 or 10 µL 1 M]
- H2O[235, 245 or 255 µL]
- final volume = 1 mL
- 4 dNTPs -- store 100 µL aliquots at -20¡C.
- dGTP, dATP, dTTP, dCTP combined, each at 2 mM