Standard PCR

Eric Kofoid (July 17, 1996)

Description
==========
These are recipes and protocols for PCR using Taq polymerase in the Idaho Technology Air Cycler. They work well for me.
Protocol
==========

Typical Reaction

8 μL H2O
2 μL 10x M-PCRB (the usual buffer)
2 μL 4 dNTPs
2 μL left primer @ 5 μM
2 μL right primer @ 5 μM
2 μL template, diluted 10-2 - 10-3
2 μL T/TS
------
20 μL

Typical settings

hold 30"x94° (chromosomal templates only)
30-40 cycles 0"x94° 0"x45-65° 15" or greater x72°
5' x 72°
Comments
==========

For analytical runs, use 10 μL (4 cm of a "10μL" Idaho-Tech glass capillary). To maximize yield, draw the entire reaction into the capillary. For preparative work, distribute a 5 or 10x reaction over several capillaries, about 20 μL per tube. Using a hot flame, seal the end of the capillary containing the short air bubble. Than, quickly draw the opposite end over the flame to expand the bubble and seal it immediately. This will prevent a glass ball from inflating.

Large volumes can also be cycled in traditional thin-walled PCR tubes by placing them in special mounts which ship with the machines. However, runs are shorter and products purer if the capillaries are used.

Open capillaries at the large bubble end first. Use a light stroke with a sapphire knife. Remove the other end and load directly into an agarose well with a Drummond capillary pump.

The correct buffer and annealing temperature can be determined by "3x3" optimization (see below). Usually, M-PCRB works fine.

Annealing temperatures can often be guessed at fairly accurately using programs such as GCG "prime". 55° is often adequate for primers greater than 18 nucleotides with average nucleotide composition and no internal structure.

As a rule of thumb, 15-30" elongation is sufficient for a typical 1 Kb piece with matched primers that bind well. Longer products do not scale linearly, and require more time than one might expect (e.g., 1-2' for 2 Kb). Don't expect to make anything larger than 5.5 Kb without resorting to other methods.

After cycling, reactions can be stored in capillaries indefinitely at room temp.

"3x3" optimizations:
==========

Make 3 40 μL reactions using H-PCRB, M-PCRB and L-PCRB, and aliquot 10μL each into 3 capillaries.
Cycle sets (H-, M-, L-PCRB) at annealing temperatures 50°, 55° or 60°.
Load in 9 adjacent wells in order:
H(50°)->M(50°)->L(50°)->H(55°)->M(55°)->L(55°)->H(60°)>-M(60°)->L(60°).
This gives increasing stringency, left to right.
Controls
==========

Single-primer PCR: Secondary primer binding sites will sometimes occur by chance near the specific site such that an unwanted amplification product flanked at both ends by the same oligonucleotide. The probability of such an event increases greatly with decreased stringency of binding. These unwanted products can be detected by running PCR reactions with each primer alone.

"Universal" positive control: The quality of any E.coli or Salmonalla chromosomal DNA preparation having an intact cheY gene can be checked using the balanced CheY universal primers:

CheY1 (TP43): ATGGCGGATAAAGAACTTAAATTTTTGG

CheY2 (TP44): AGTCGCATCCTCACATGCCCAGTTTCTCAAAGAT


The product size is 399. The oligonucleotides were designed by Knut Jahreis, and work equally well in both organisms under nearly all possible conditions. For instance, in a standard "3x3" optimization, these two primers will yield 9 nearly identical lanes, each with a single band of size 399 bp.
Materials
==========

Enzyme Dilution Buffer (EDB) -- store 1 mL aliquots at -20°.
10 mM Tris, pH 8.3 [10 μL 1M ]
2.5 mg/mL BSA (crystalline, not acetylated!) [25 μL 100 mg/mL] [0.97 mL H2O -> 1 mL]

10x Taq polymerase stock (T/TS) -- store 100 μL aliquots at -20°C
1 μL Taq @ 5 u/μL
1 μL TaqStart antibody @ Clontech's concentration.
10.5 μL EDB

10x H-, M- or L-PCRB -- store at -20°C.
500 mM Tris, pH8.3 [500 μL 1 M]
2.5 mg/mL BSA (crystalline, not acetylated!) [25 μL 100 mg/mL]
5% Ficoll [200 μL 25%]
1 mM Cresol Red [10 μL 100 mM]
30, 20 or 10 M MgCl2 [30, 20 or 10 μL 1 M]
H2O[235, 245 or 255 μL]
final volume = 1 mL

4 dNTPs -- store 100 μL aliquots at -20°C.
dGTP, dATP, dTTP, dCTP combined, each at 2 mM

Last Update: Friday, 01-May-2015 11:33:42 PDT
This page has been viewed 105 times.
Eric Kofoid eckofoid at ucdavis.edu