DNA Hybridization - Kinased Oligonucleotides
Jeff Lawrence
1. Prehybridize filters at 65° for 2 hr. Remove fluid from bag and rinse twice with hybridization fluid if different.
2. Add 5 mL hybridization fluid per 15 cm2 of filter:
6 X NET
0.5 % Sarkosyl
100 mg/mL Denatured Salmon Sperm DNA
20X NET is:
3.0 M NaCl 60 mL 5 M NaCl
0.3 M Tris, pH 7.5 30 mL 1 M Tris, pH 7.5
20 mM EDTA 4 mL 500 mM EDTA
6 mL ddH2O
3. Add purified kinased oligonucleotide to a concentration of 1 ng/mL.
4. Seal bag and hybridize at 22° for 2 hr.
5. Remove filter and place in 500 mL of Rinse Solution:
6 X SSC 300 mL 20X SSC
0.06 % NaPyrophosphate 100 mL 0.6% NaPP
20 mM NaPO4, pH 7 20 mL 1 M NaPO4, pH 7
0.1 % SDS 10 mL 10% SDS
570 mL ddH2O
6. Rinse with shaking for 5 min. Repeat rinse.
7. Transfer filter to 500 mL Rinse Solution preheated to the Tm calculated as:
4*(# of G or C bases) + 2*(# of A or T bases)
example, melting of GCACTTGAATCTAGGATCCG is :
4*(10) + 2*(10) = 40 + 20 = 60°
8. Rinse with agitation for 2 min. Remove and wrap in plastic wrap.
Last Update: Thursday, 12-Dec-2024 00:55:21 UTC
This page has been viewed [an error occurred while processing this directive]
times.
Eric Kofoid
eckofoid at ucdavis.edu