DNA Reaction - Polymerase Chain Reaction

Jeff Lawrence

1. Calculate the annealing temperature of oligos as:

	4*(# of G or C bases)  +  2*(# of A or T bases)  -  3

Example: melting of GCACTTGAATCTAGGATCCG is :

	4*(10) + 2*(10) - 3  =  40 + 20 - 3  =  60 - 3  =  57°

Use the lowest temperature as the annealing temperature:

2. Program Thermal Cycler with the following parameters:

	Step		Temp	Time
	=======		======	======
	Melting		94°	30 sec
	Annealing	40-65°	30 sec
	Extending	72°	1 min per kilobase target.

3. Dilute template DNA:

	Template	Concentration (per mL)
	========	=============
	Eucaryotic	20 ng
	Bacterial	5 ng
	Lambda		1 ng
	Plasmid		100 pg
	PCR Product	50 pg

4. Mix the following:

	1.0 µL	Template DNA (1/100 dilution of chromosomal DNA)
	2.0 µL	10X TAQ Buffer (MgCl₂ between 1 and 3 mM final)
	2.0 µL	8 mM dNTP (2 mM each)
	2.0 µL	5 mM Primer 1
	2.0 µL	5 mM Primer 2
	0.1 µL	TAQ Polymerase, at 5 unit/µL
	10.9 µL	ddH₂O						
	20.0 µL	Total volume

5. Cycle for 25 cycles, up to 30 cycles for eukaryotic templates.

Last Update: Thursday, 12-Dec-2024 00:55:25 UTC

This page has been viewed [an error occurred while processing this directive] times.

Eric Kofoid eckofoid at ucdavis.edu