DNA Reaction - PCR in Air Cyclers

Jeff Lawrence

1. Calculate the annealing temperature of oligos as:

	4*(# of G or C bases)  +  2*(# of A or T bases)  -  3

example, melting of GCACTTGAATCTAGGATCCG is :

	4*(10) + 2*(10) - 3  =  40 + 20 - 3  =  60 - 3  =  57°

Use the lowest temperature as the annealing temperature:

2. Program Air Cycler with the following parameters:

	Step		Temp.	Time
        ======		======	=====
	Melting		94°	2 sec
	Annealing	40-72°	2 sec
	Extending	72°	15 sec + 40 sec per kilobase target.

3. Dilute template DNA:

  	Template	Concentration (per mL)
	==========	=============
	Eucaryotic	20 ng
	Bacterial	5 ng
	Lambda		1 ng
	Plasmid		100 pg
	PCR Product	50 pg

4. Mix the following:

	1.0 µL	Template DNA 
	2.0 µL	10X TAQ Buffer (MgCl2 between 1 and 3 mM final)
	2.0 µL	8 mM dNTP (2 mM each)
	2.0 µL	5 mM Primer 1
	2.0 µL 	5 mM Primer 2
	0.1 µL	TAQ Polymerase, at 5 unit/mL
	10.9 µL	ddH₂O						
	20.0 µL	Total volume

5. Load sample into a glass capillary tube and seal both ends.

6. Cycle for 30 cycles with a rapid slope between temperatures

Last Update: Thursday June 19 2014

This page has been viewed Failed to execute CGI : Win32 Error Code = 2
times.

Eric Kofoid eckofoid at ucdavis.edu